View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7224_low_20 (Length: 230)
Name: NF7224_low_20
Description: NF7224
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7224_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 47577401 - 47577615
Alignment:
| Q |
1 |
gaccgggacctacaatgccatattattaacatccaaggacgcacatgatcatgatgtgatgataatgtttatgttatcatcgtttgttacatgtttt-tt |
99 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47577401 |
gaccgggacccacaatgccatatta---acatccaagcacgcacatgatcatgatgtgatgataatgtttatgttatcatcgtttgttacatgttttttt |
47577497 |
T |
 |
| Q |
100 |
atgttatgatagcatatgataatatacactaccatacaactaacccaatcgccaacaaaattgtgggtgtattttatggctctatgcattatgtcatcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47577498 |
atgttatgatagcatatgataatatacactaccatacaactaacccaatcgccaacaaaattgtgggtgtattttatggctctatgcattatgtcatcat |
47577597 |
T |
 |
| Q |
200 |
gtcctatccaactcattc |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47577598 |
gtcctatccaactcattc |
47577615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University