View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7226_low_17 (Length: 273)
Name: NF7226_low_17
Description: NF7226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7226_low_17 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 211 - 273
Target Start/End: Complemental strand, 1834632 - 1834570
Alignment:
| Q |
211 |
cataatttcaatgtctaactgatgtgtctatataaaaatatatgttgagagatatcattccat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1834632 |
cataatttcaatgtctaactgatgtgtctatataaaaatatatgttgagagatatcattccat |
1834570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 169 - 214
Target Start/End: Complemental strand, 1835914 - 1835869
Alignment:
| Q |
169 |
tgacacaagtgatcggtagttgagtcacttaattagccatatcata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1835914 |
tgacacaagtgatcggtagttgagtcacttaattagccatatcata |
1835869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 133
Target Start/End: Complemental strand, 1835981 - 1835949
Alignment:
| Q |
101 |
ttttaaggttgaccatttcatttatagaacaac |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1835981 |
ttttaaggttgaccatttcatttatagaacaac |
1835949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University