View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7226_low_24 (Length: 221)
Name: NF7226_low_24
Description: NF7226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7226_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 147
Target Start/End: Original strand, 37946030 - 37946158
Alignment:
| Q |
19 |
gtgttgtgttaattatgcatttttaggggactaccctgttggtcatttagattgcttagtaacatatcagattcaagttctaagacaattcatgttacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37946030 |
gtgttgtgttaattatgcatttttaggggactaccctgttggtcatttagattgcttagtaacatatcagattcaagttctaagacaattcatgttacat |
37946129 |
T |
|
| Q |
119 |
cccaatctaagatcatgttttataattag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37946130 |
cccaatctaagatcatgttttataattag |
37946158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University