View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7226_low_5 (Length: 397)
Name: NF7226_low_5
Description: NF7226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7226_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 18 - 387
Target Start/End: Complemental strand, 54733426 - 54733057
Alignment:
| Q |
18 |
acttcatttattcgtagcttctgttgtcttgcaatgaatgcctccacggtgcgacgaaattcgtcgctgctcattccatcttcgggatataaactccatt |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54733426 |
acttcatttattcgtagcttccgttgtcttgcaatgaatgcctccaccgtgcgacgaaattcgtcgctgctcattccatcttcaggatataaactccatt |
54733327 |
T |
|
| Q |
118 |
ttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcacacctttgcaacactctttgatccttcgcatcatcactattcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733326 |
ttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcacacctttgcaacactctttgatccttcgcatcatcactattcac |
54733227 |
T |
|
| Q |
218 |
acccctcaccaactcaatttccgattgacacctcctatatcccttcacttccaaacccatctctgtttttatctcctgtttctcttccaacttcattttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733226 |
acccctcaccaactcaatttccgattgacacctcctatatcccttcacttccaaacccatctctgtttttatctcctgtttctcttccaacttcattttg |
54733127 |
T |
|
| Q |
318 |
ttatcatcttcactctttatactctctttttcagagaatttcaccatgcatccatcgtatattcttcgac |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
54733126 |
ttatcatcttcactctttatactctctttttgagagaatttcaccatgcatccatcgtttattctacgac |
54733057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University