View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7227_high_5 (Length: 292)
Name: NF7227_high_5
Description: NF7227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7227_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 41565819 - 41565984
Alignment:
| Q |
1 |
tcgcaaggattgggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
41565819 |
tcgcaaggattgggtttttgttttgttttcaccatctgtttcagttcgtcggttattcagtcaccggtgggctgtttgcttttgtaggatctctggcttt |
41565918 |
T |
 |
| Q |
101 |
ttgattttgtattttcagtttaggttggtgcgtcctcttttggtgcttgcttttgttcgcgccgaa |
166 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41565919 |
ttggttttgtattttcagtttaggttgttgcgtccttttttggtgcttgcttttgttcgcgccgaa |
41565984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 156
Target Start/End: Complemental strand, 1030131 - 1029990
Alignment:
| Q |
13 |
ggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcattttgattttgtat |
112 |
Q |
| |
|
||||||||||||||||||||||| | |||| |||||| |||| ||| |||| | ||| |||| ||||||| |||||||||| | |||||||||||| | |
|
|
| T |
1030131 |
ggtttttgttttgttttcgccggatatttcggttcgtcggtt-ttccgtcacctgtgagctgcttgctttggtaggatctcagaatttttgattttgtgt |
1030033 |
T |
 |
| Q |
113 |
tttcagtttaggttggtgcgtcctcttttggtgcttgcttttgt |
156 |
Q |
| |
|
|||| ||| ||||||||| |||||||||||| | |||||||| |
|
|
| T |
1030032 |
tttcgattttggttggtgc-acctcttttggtgttggcttttgt |
1029990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 13 - 166
Target Start/End: Original strand, 48562884 - 48563036
Alignment:
| Q |
13 |
ggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcattttgattttgtat |
112 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||| || | || ||| |||| ||||||| ||||||||||||| ||||||| ||| ||||| |||||| | |
|
|
| T |
48562884 |
ggtttttgttttgtttccgcctgctgtttcggtttgtcgttttttc-gtcaccggtgggttgtttgcttttgttggatctccggctttttggttttgtgt |
48562982 |
T |
 |
| Q |
113 |
tttcagtttaggttggtgcgtcctcttttggtgcttgcttttgttcgcgccgaa |
166 |
Q |
| |
|
| | |||| ||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
48562983 |
tccctgtttgggttggtgcaccctcttttggtgctggcttttgttcgcgccgaa |
48563036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University