View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7227_low_6 (Length: 292)

Name: NF7227_low_6
Description: NF7227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7227_low_6
NF7227_low_6
[»] chr8 (2 HSPs)
chr8 (1-166)||(41565819-41565984)
chr8 (13-156)||(1029990-1030131)
[»] chr1 (1 HSPs)
chr1 (13-166)||(48562884-48563036)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 41565819 - 41565984
Alignment:
1 tcgcaaggattgggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcatt 100  Q
    |||||||||||||||||||||||||||||| ||  |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||    
41565819 tcgcaaggattgggtttttgttttgttttcaccatctgtttcagttcgtcggttattcagtcaccggtgggctgtttgcttttgtaggatctctggcttt 41565918  T
101 ttgattttgtattttcagtttaggttggtgcgtcctcttttggtgcttgcttttgttcgcgccgaa 166  Q
    ||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
41565919 ttggttttgtattttcagtttaggttgttgcgtccttttttggtgcttgcttttgttcgcgccgaa 41565984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 13 - 156
Target Start/End: Complemental strand, 1030131 - 1029990
Alignment:
13 ggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcattttgattttgtat 112  Q
    ||||||||||||||||||||||| | |||| |||||| |||| ||| |||| | ||| |||| ||||||| |||||||||| |   |||||||||||| |    
1030131 ggtttttgttttgttttcgccggatatttcggttcgtcggtt-ttccgtcacctgtgagctgcttgctttggtaggatctcagaatttttgattttgtgt 1030033  T
113 tttcagtttaggttggtgcgtcctcttttggtgcttgcttttgt 156  Q
    ||||  ||| |||||||||  |||||||||||| | ||||||||    
1030032 tttcgattttggttggtgc-acctcttttggtgttggcttttgt 1029990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 13 - 166
Target Start/End: Original strand, 48562884 - 48563036
Alignment:
13 ggtttttgttttgttttcgccggctgtttcagttcgttggttattcagtcatcggtgggctgtttgcttttgtaggatctctggcattttgattttgtat 112  Q
    |||||||||||||||| |||| |||||||| ||| || | || ||| |||| ||||||| ||||||||||||| ||||||| ||| ||||| |||||| |    
48562884 ggtttttgttttgtttccgcctgctgtttcggtttgtcgttttttc-gtcaccggtgggttgtttgcttttgttggatctccggctttttggttttgtgt 48562982  T
113 tttcagtttaggttggtgcgtcctcttttggtgcttgcttttgttcgcgccgaa 166  Q
    |  | |||| |||||||||  |||||||||||||| ||||||||||||||||||    
48562983 tccctgtttgggttggtgcaccctcttttggtgctggcttttgttcgcgccgaa 48563036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University