View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7228_low_11 (Length: 263)
Name: NF7228_low_11
Description: NF7228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7228_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 1035523 - 1035752
Alignment:
| Q |
19 |
gaattgtttcaaatgacatttgcagttttgtattgcactttgatatgatggtaaaatgcattgaatgcggtcgtaatttcggttatgatgccatgcacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1035523 |
gaattgtttcaaatgacatttgcagttttgtattggactttgatatgatggtaaaatgcattgaatgcggtcgtaatttcggttatgatgccatgcacaa |
1035622 |
T |
 |
| Q |
119 |
acatctaaaatattgatatcaagattcccataaacataatcttaattctctctagtgatatagtatttctttatcgcaattcttccactacttactaact |
218 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1035623 |
acatctaaaatattgatataaagaat-ccataaacataatcttaattctctctggtgata---tatttctttatcgcaattcttccactacttactaact |
1035718 |
T |
 |
| Q |
219 |
tcactatgattttatttgcataatccacaggttc |
252 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
1035719 |
tcactatgattttatttgcataatctacaggttc |
1035752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University