View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7228_low_12 (Length: 201)
Name: NF7228_low_12
Description: NF7228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7228_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 3e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 4263524 - 4263461
Alignment:
| Q |
15 |
gaacctgtgaagcacggacgctcttttggttgaactgaggttgaattgcagttggttcaattgg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263524 |
gaacctgtgaagcacggacgctcttttggttgaactgaggttgaattgcagttggttcaattgg |
4263461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 4263410 - 4263351
Alignment:
| Q |
129 |
gtcatccagttcaagcatatggttgaatcaattttaccatgatacataggtctcacaggttc |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4263410 |
gtcatccagttcaagcat--ggttgaatcaattttaccatgatacataggtctcacaggttc |
4263351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University