View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7228_low_3 (Length: 439)
Name: NF7228_low_3
Description: NF7228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7228_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 17 - 423
Target Start/End: Original strand, 49575967 - 49576373
Alignment:
| Q |
17 |
caaaaccctccgcacttatggcttcactaactccgattccgattccaacagcctcactctttctcctatgcaacaatacgaaggccatcagcacggcgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49575967 |
caaaaccctccgcacttatggcttcactaactccgattccgattccaacagcctcactctttctcctatgcaacaatacgaaggccatcagcacggcgtt |
49576066 |
T |
 |
| Q |
117 |
tccgacctcgctttctcctccgattcccgctaccttgtctccgcctccgacgacaaaaccatccgtttatgggatgttccgacgggttcgcttgtgaaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49576067 |
tccgacctcgctttctcctccgattcccgctaccttgtctccgcctccgacgacaaaaccatccgtttatgggatgttcctacgggttcgcttgtgaaga |
49576166 |
T |
 |
| Q |
217 |
ctcttcacggtcatacgaattacgttttctgtgttaattttaatcctcagagtaatgttattgtttctggttcgtttgatgagactgttagggtttggga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49576167 |
ctcttcacggtcatacgaattacgttttctgtgttaattttaatcctcagagtaatgttattgtttctggttcgtttgatgagactgttagggtttggga |
49576266 |
T |
 |
| Q |
317 |
tgttaagtctgggaagtgtcttaaggttttacctgcgcattctgatccggtgactgctgttgattttaaccgcgatgggactcttattgtttccagtagt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49576267 |
tgttaagtctgggaagtgtcttaaggttttacctgcgcattctgatccggtgactgctgttgattttaaccgcgatgggactcttattgtttccagtagt |
49576366 |
T |
 |
| Q |
417 |
tatgatg |
423 |
Q |
| |
|
||||||| |
|
|
| T |
49576367 |
tatgatg |
49576373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 331
Target Start/End: Complemental strand, 32005013 - 32004961
Alignment:
| Q |
279 |
gtttctggttcgtttgatgagactgttagggtttgggatgttaagtctgggaa |
331 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| || ||| ||||||| |
|
|
| T |
32005013 |
gtttcgggttcgtttgatgagacggttagggtttgggaagtgaagactgggaa |
32004961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University