View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7228_low_9 (Length: 313)
Name: NF7228_low_9
Description: NF7228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7228_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 10 - 298
Target Start/End: Complemental strand, 3621741 - 3621452
Alignment:
| Q |
10 |
gcagagatgagacgagagagacccatagggtgggtcatacaaattcattaatttgatttgattgatcatactacaagctaattaattagatgggactcaa |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3621741 |
gcagagatgagacgagagagacccaaagggtgggtcatacaaattcattaatttgatttgattgatcatactacaagctaattaattagatgggactcaa |
3621642 |
T |
 |
| Q |
110 |
aatgtgaaagtgtccactaaatgacatcttccaaatccataatttgattgtatggg-acgaaccatattcacgagcagcagctcatatatcaaagtattc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3621641 |
aatgtgaaagtgtccactaaatgacatctcccaaatccataatttgattgtatgggaacgaaccatattcacgagcagcagctcatatatcaaagtattc |
3621542 |
T |
 |
| Q |
209 |
caccaacacgtacaacggcttcccattcaaacgttcacgaccctgtcacatatgtacgtacgtattcacatgaaccatttggctaaaact |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3621541 |
caccaacacgtacaacggcttcccattcaaacgttcacgaccctgtcacatatgtacgtacgtattcacatgaatcatttggctaaaact |
3621452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University