View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7229_high_30 (Length: 253)
Name: NF7229_high_30
Description: NF7229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7229_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 49932460 - 49932684
Alignment:
| Q |
11 |
aacctgtgttgcaagtagctcaacttcaccgttgtcgaataccaatatgcccttaggtgttatacatttgggatgggtgagaccattcaactcgagctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49932460 |
aacctgtgttgcaagtagctcaacttcaccgttgtcgaataccaatatgcccttaggtgttatacatttgggatgggtgagaccattcaactcgagctct |
49932559 |
T |
 |
| Q |
111 |
ccactaacagtaaatataagaatcagaggatacactatcttcaattctggcccaagcacaagcttcaaatcactaaggcgggtttctatacttggtttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49932560 |
ccactaacagtaaatataagaatcagaggatacactatcttcaattctggcccaagcacaagcttcaaatcactaaggcgggtttctatacttggtttta |
49932659 |
T |
 |
| Q |
211 |
tcagcattttctccatgtccttgtc |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49932660 |
tcagcattttctccatgtccttgtc |
49932684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 189
Target Start/End: Complemental strand, 1915199 - 1915045
Alignment:
| Q |
35 |
ttcaccgttgtcgaataccaatatgcccttaggtgttatacatttgggatgggtgagaccattcaactcgagctctccactaacagtaaatataagaatc |
134 |
Q |
| |
|
|||||| || || ||| ||| |||||| ||||| |||| ||||||||||| | |||||||||||||| ||||||||||| |||| ||| | |||||| |
|
|
| T |
1915199 |
ttcaccattctcaaatgccagtatgcctctaggttttatccatttgggatgagccagaccattcaactcaagctctccactgacagcaaaattgagaatc |
1915100 |
T |
 |
| Q |
135 |
agaggatacactatcttcaattctggcccaagcacaagcttcaaatcactaaggc |
189 |
Q |
| |
|
| |||||| |||||||| || ||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
1915099 |
aaaggatatactatctttaactctggtccaaggacaagcttcaaatcattaaggc |
1915045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University