View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7229_low_13 (Length: 493)
Name: NF7229_low_13
Description: NF7229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7229_low_13 |
 |  |
|
| [»] chr6 (24 HSPs) |
 |  |
|
| [»] chr5 (38 HSPs) |
 |  |
|
| [»] chr2 (42 HSPs) |
 |  |
|
| [»] chr8 (32 HSPs) |
 |  |
|
| [»] chr4 (54 HSPs) |
 |  |
|
| [»] chr3 (51 HSPs) |
 |  |
|
| [»] chr1 (34 HSPs) |
 |  |
|
| [»] scaffold0426 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |
|
| [»] scaffold0350 (1 HSPs) |
 |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 35)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 160 - 438
Target Start/End: Original strand, 25047471 - 25047752
Alignment:
| Q |
160 |
tactttttattatgaagcgaaaaatgtagaagagtttgtgattgtgaaaaagacctttgaccacaatcctacaacagatttatttatggtcctagttcta |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047471 |
tactttttattatgaagcgaagaatgtagaagagtttctgattgtgaaaaagacctttgaccacaatcctacaacagatttatttatggtcctagttcta |
25047570 |
T |
 |
| Q |
260 |
cactacgtaccatgtaggtaatggtcaaggtcacaattgatttttattgaaaaggaagaattgatcttttgatacactataagcatttcgtatacaacta |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25047571 |
cactacgtaccatgtaggtaatggtcaaggtcacaattgatttttattgaaaaggaagaattgatctattgatacactataagcatttcgtatacaacta |
25047670 |
T |
 |
| Q |
360 |
cacctcctttaattgctgaactagcacaagattataaaaagaaaat---cattgattcatcatcctcgggaagatggtataa |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
25047671 |
cacctcctttaattgctgaactagcacaagatcataaaaagaaaatcaccattgattcatcatcctcgcgaagatggtataa |
25047752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 14 - 168
Target Start/End: Original strand, 25047096 - 25047252
Alignment:
| Q |
14 |
atatgttatttaagatactttacacaagtttatgcaatgcttgctgccgcgtaattc----tcaatggtaaaaataaaatgttaagctacggtttaatgt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
25047096 |
atatgttatttaagatactttacacaagtttatgcaatgcttgctgccgcgtaattccttctcaatggtaaaaa--atatgttaagctacggtttaatgt |
25047193 |
T |
 |
| Q |
110 |
gttttatgcaacctttaaatactttcattaaagatgctctaattataccatacttttta |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25047194 |
gttttatgcaacctttaaatactttcattaaagatgctctaattataccatacttttta |
25047252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 1046627 - 1046582
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1046627 |
gtggtgatcgggattcgaaccccagaccttacatatattatgcatt |
1046582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 7872738 - 7872785
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7872738 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcattgt |
7872785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 46987157 - 46987110
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
46987157 |
gtggtgtccggggttcgaaccccggaccttgcatatattatgcattgt |
46987110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 9522982 - 9522936
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcattgt |
9522936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Complemental strand, 19793583 - 19793545
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19793583 |
ggggttcgaaccccagaccttacatatattatacattgt |
19793545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 6384912 - 6384875
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6384912 |
gggttcgaaccccagaccttgcatatattatgcattgt |
6384875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 22690026 - 22690071
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
22690026 |
gtggtgtccggggttcgaaccccaaaccttgcatatattatgcatt |
22690071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 26009347 - 26009302
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
26009347 |
gtggtgtccggagttcgaaccccagaccttgcatatattatgcatt |
26009302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 2916166 - 2916126
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
2916166 |
ccggggttcgaatcccagaccttgcatatattatgcattgt |
2916126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 38553878 - 38553842
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38553878 |
ggttcgaaccccaaaccttacatatattatgcattgt |
38553842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 8084498 - 8084451
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
8084498 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcattgt |
8084451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 8261433 - 8261480
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
8261433 |
gtggtggccgggattcgaaccccaaaccttacatattttatgcattgt |
8261480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 27462426 - 27462473
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
27462426 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
27462473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 27833399 - 27833438
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
27833399 |
cggggtttgaaccccggaccttacatatattatgcattgt |
27833438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 31292759 - 31292806
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| |||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
31292759 |
gtggtggccggagttcgaaccccagaccttgcatgtattatgcattgt |
31292806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 37624614 - 37624567
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
37624614 |
gtggtggccgggattcgaacccccgaccttgcatatattatgcattgt |
37624567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 40187634 - 40187673
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
40187634 |
cggggtttgaaccgcagaccttacatatattatgcattgt |
40187673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 47155094 - 47155141
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
47155094 |
gtggtgtccggggttcgaaccctggaccttgcatatattatgcattgt |
47155141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 10424031 - 10423985
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
10424031 |
tggtggccggggttcgaacctcagaccttatatatattatgcgttgt |
10423985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Complemental strand, 24839550 - 24839512
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
24839550 |
ggggatcgaaccccagaccttacatattttatgcattgt |
24839512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 452 - 493
Target Start/End: Complemental strand, 5041404 - 5041363
Alignment:
| Q |
452 |
accggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
5041404 |
accggtgtttgaaccccagaccttgcatatattatgcattgt |
5041363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 487
Target Start/End: Original strand, 7994882 - 7994915
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatg |
487 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
7994882 |
cggggtttgaaccccagaccttacatatattatg |
7994915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 9139514 - 9139477
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
9139514 |
gggttcgaactccagactttacatatattatgcattgt |
9139477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 16537526 - 16537571
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
16537526 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcatt |
16537571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 16628136 - 16628091
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
16628136 |
gtggtgaccgaggtttgaaccccagaccttgtatatattatgcatt |
16628091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 487
Target Start/End: Original strand, 23069847 - 23069888
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatg |
487 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
23069847 |
gtggtgtccggggttcgaaccccataccttgcatatattatg |
23069888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 460 - 493
Target Start/End: Complemental strand, 37864482 - 37864449
Alignment:
| Q |
460 |
tcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
37864482 |
tcgaaccccagaccttgcatatattatgcattgt |
37864449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 43539104 - 43539141
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgt |
43539141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 45151440 - 45151403
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
45151440 |
cggggtttgaaccccaaaccttacatatattatgcatt |
45151403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 48837938 - 48837893
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
48837938 |
gtggtggccggggttcgaaccccaaactttgcatatattatgcatt |
48837893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 486
Target Start/End: Original strand, 10954911 - 10954943
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattat |
486 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
10954911 |
cggggttcaaaccccagaccttacatatattat |
10954943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 21050223 - 21050259
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
21050223 |
ggttcgaaacccagaccttgcatatattatgcattgt |
21050259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 35165593 - 35165557
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
35165593 |
ggttcgaacctcagaccttacatatattatgtattgt |
35165557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 2726407 - 2726454
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2726407 |
gtggtgaccggggttcgaaccccggaccttgcatatattatgcattgt |
2726454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 28592677 - 28592724
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28592677 |
gtggtgtccgaggttcgaaccccagaccttacatatattatgcattgt |
28592724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 9333970 - 9334017
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9333970 |
gtggtgtccgaggttcgaaccccaaaccttacatatattatgcattgt |
9334017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 9973288 - 9973242
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9973288 |
tggtggccggagttcgaaccccaaaccttacatatattatgcattgt |
9973242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Complemental strand, 12808931 - 12808893
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
12808893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 655746 - 655786
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
655746 |
ccggggttcgaaccccggaccttgcatatattatgcattgt |
655786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 8138459 - 8138495
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8138459 |
ggtttgaaccccagaccttacatatattatgcattgt |
8138495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 4450333 - 4450286
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| | |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
4450333 |
gtggtgaccgagattcgaaccccggaccttgcatatattatgcattgt |
4450286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 8569780 - 8569733
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
8569780 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
8569733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 9111110 - 9111071
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
9111110 |
cggggttcgaaccccggaccttgcatatattatgcattgt |
9111071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 11456366 - 11456412
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
11456366 |
gtggtggccggggtttgaacccc-gaccttacatatattatgcattgt |
11456412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 12700411 - 12700458
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
12700411 |
gtggtggccggggttcaaaccctagaccttgcatatattatgcattgt |
12700458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 20744201 - 20744162
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
20744201 |
cggggtttgaaccccagaccttgcatatattatgcattgt |
20744162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 25165348 - 25165301
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| | ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25165348 |
gtggtggctggggttcgaacgccggaccttacatatattatgcattgt |
25165301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 29431530 - 29431483
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
29431530 |
gtggtgtccggggatcgaacctcagaccttacatacattatgcattgt |
29431483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 34828377 - 34828330
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacata-tattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
34828377 |
tggtggccggggttcgaacctcagaccttacatattattatgcattgt |
34828330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 485
Target Start/End: Complemental strand, 8917670 - 8917632
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatatta |
485 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8917670 |
tggtggccggggtttgaaccccagaccttacatatatta |
8917632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Complemental strand, 10778898 - 10778864
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
10778898 |
ttcgaacctcagaccttacatatattatgcattgt |
10778864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 16390499 - 16390453
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
16390499 |
tggtggccgaggtttgaaccccggaccttacatatattatgcattgt |
16390453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 12306392 - 12306347
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
12306392 |
gtggtggccggggtttgaacctcagaccttacatatattattcatt |
12306347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 27907941 - 27907986
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
27907941 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 12841867 - 12841915
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatata-ttatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
12841867 |
gtggtgtccggtgttcgaaccccggaccttacatatatttatgcattgt |
12841915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 15155795 - 15155759
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15155795 |
ggtttgaaccccagaccttgcatatattatgcattgt |
15155759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 35110116 - 35110080
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35110116 |
ggggttcgaacctcaaaccttacatatattatgcatt |
35110080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 38)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 26655535 - 26655488
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26655535 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26655488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 26927120 - 26927073
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26927120 |
gtggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26927073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 6489078 - 6489031
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6489078 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
6489031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 6624847 - 6624800
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
6624847 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
6624800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 26409316 - 26409277
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26409316 |
cggggttcgaaccccggaccttacatatattatgcattgt |
26409277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 31708136 - 31708183
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31708136 |
gtggtgtccgaggttcgaaccccagaccttgcatatattatgcattgt |
31708183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 455 - 492
Target Start/End: Original strand, 1257153 - 1257190
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattg |
492 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1257153 |
ggggttcgaaccccagaccttacatattttatgcattg |
1257190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 5150080 - 5150120
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacata-tattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5150080 |
cggggttcgaaccccagaccttacatattattatgcattgt |
5150120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 459 - 491
Target Start/End: Complemental strand, 7215808 - 7215776
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7215808 |
ttcgaaccccagaccttacatatattatgcatt |
7215776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 22522791 - 22522838
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
22522791 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 458 - 493
Target Start/End: Original strand, 23118053 - 23118088
Alignment:
| Q |
458 |
gttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23118053 |
gttcgaaccccaaaccttacatatattatgcattgt |
23118088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 458 - 493
Target Start/End: Original strand, 25607060 - 25607095
Alignment:
| Q |
458 |
gttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25607060 |
gttcgaaccccagaccttgcatatattatgcattgt |
25607095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 32339806 - 32339759
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
32339806 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 32559375 - 32559328
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
32559375 |
gtggtggccgggatttgaaccccagaccttacatattttatgcattgt |
32559328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 37932401 - 37932354
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| || ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
37932401 |
gtggtggccagggttcgaaccccggaccttgcatatattatgcattgt |
37932354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 40715939 - 40715986
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
40715939 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
40715986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 42168935 - 42168982
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
42168935 |
gtggtgtctggggttcgaaccccagaccttgcatatactatgcattgt |
42168982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 5846099 - 5846053
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
5846099 |
tggtgtccggggtttgaaccccagactttgcatatattatgcattgt |
5846053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 9595621 - 9595576
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
9595621 |
tggtgaccggggtttgaacccc-gaccttacatattttatgcattgt |
9595576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 16089520 - 16089474
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
16089520 |
tggtggccggggttcgaatcccagaccttgcaaatattatgcattgt |
16089474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 22499011 - 22498966
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
22499011 |
tggtgtccggggttcgaaccc-agaccttgcatatattatgcattgt |
22498966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 463 - 493
Target Start/End: Original strand, 36162896 - 36162926
Alignment:
| Q |
463 |
aaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36162896 |
aaccccagaccttacatatattatgcattgt |
36162926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 42708045 - 42707999
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
42708045 |
tggtggccgggattcgaatcccagaccttgcatatattatgcattgt |
42707999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 16094120 - 16094083
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
16094120 |
cggggtttgaaccccagatcttacatatattatgcatt |
16094083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 17083583 - 17083628
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| | |||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
17083583 |
gtggtggctggggtttgaactccagaccttacatatattatgcatt |
17083628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 457 - 490
Target Start/End: Original strand, 17465396 - 17465429
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
17465396 |
ggttcgaaccccagaccttgcatatattatgcat |
17465429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 37614340 - 37614377
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
37614340 |
gggttcgaatcccagaccttgcatatattatgcattgt |
37614377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 37791077 - 37791114
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
37791077 |
gggttcgaatcccagaccttgcatatattatgcattgt |
37791114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 3222795 - 3222755
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
3222795 |
ccggggttcgaacctcagaccttgcatatattatgtattgt |
3222755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 4763187 - 4763223
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
4763187 |
ggtttgaaccccggaccttacatatattatgcattgt |
4763223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 486
Target Start/End: Original strand, 5145058 - 5145098
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattat |
486 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5145058 |
gtggtgaccgaggtttcaaccccagaccttacatatattat |
5145098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 5614827 - 5614791
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5614827 |
ggggtttgaacccccgaccttacatatattatgcatt |
5614791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 12611036 - 12611072
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
12611036 |
ggttcgaaccccagaccttgcatattttatgcattgt |
12611072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Complemental strand, 24408558 - 24408522
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
24408558 |
cggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 26590771 - 26590731
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
26590771 |
ccgggattcaaaccccagaccttgcatatattatgcattgt |
26590731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 33014245 - 33014281
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
33014245 |
ggtttgaaccccagacctttcatatattatgcattgt |
33014281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 454 - 490
Target Start/End: Original strand, 37073766 - 37073802
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37073766 |
cggggttcgaaccccgaaccttacatatattatgcat |
37073802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 40175713 - 40175677
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
40175713 |
ggttcgaaccccagatcatacatatattatgcattgt |
40175677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 42)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 2257042 - 2256995
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2257042 |
gtggtggccggggttcgaaccccagaccttgcatatattatgcattgt |
2256995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 25274827 - 25274866
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25274827 |
cggggttcgaaccccagaccttacatatattatgcattgt |
25274866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 24393316 - 24393269
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
24393316 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgcattgt |
24393269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 24592836 - 24592883
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24592836 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
24592883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 41853435 - 41853389
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41853435 |
tggtggccggggttcgaacgccggaccttacatatattatgcattgt |
41853389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 2264868 - 2264823
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2264868 |
gtggtgtccagggttcgaaccccaaaccttacatatattatgcatt |
2264823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 3904263 - 3904226
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgt |
3904226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 22607223 - 22607178
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
22607223 |
gtggtgtccggggctcgaaccccggaccttacatatattatgcatt |
22607178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 27152424 - 27152379
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27152424 |
gtggtgtcctgggttcgaaccccagaccttgcatatattatgcatt |
27152379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 42102158 - 42102113
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42102158 |
gtggtggccggggttcgaaccacagacattacatatattatgcatt |
42102113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 5028920 - 5028880
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
5028920 |
ccggggtttgaaccccaaaccttacatatattatgcattgt |
5028880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 6579278 - 6579318
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6579278 |
ccgggattcgaaccccagaccttgcatatattatgcattgt |
6579318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 12599863 - 12599902
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
12599863 |
cggggttcgaaccccagaccttgcatatattatgtattgt |
12599902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 17452702 - 17452655
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
17452702 |
gtggtggccagggtttgaaccccagaccttacatatattattcattgt |
17452655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 20455962 - 20455915
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20455962 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
20455915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 21258687 - 21258640
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
21258687 |
gtggtggccgggattcgaaccccagaccttgcatatatcatgcattgt |
21258640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 489
Target Start/End: Complemental strand, 27411163 - 27411120
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgca |
489 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
27411163 |
gtggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 29544698 - 29544651
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
29544698 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 489
Target Start/End: Complemental strand, 34903588 - 34903545
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgca |
489 |
Q |
| |
|
|||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
34903588 |
gtggtgtccggggttcgaacctcagaccttgcatatattatgca |
34903545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 39384152 - 39384199
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
39384152 |
gtggtgatcgggactcgaacctcagaccttacatatattatgcattgt |
39384199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 41187447 - 41187494
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| ||| || ||||| ||||||||||| |
|
|
| T |
41187447 |
gtggtgaccggggttcgaaccccggactttgcatattttatgcattgt |
41187494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 41859922 - 41859876
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
41859876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 486
Target Start/End: Original strand, 2939780 - 2939813
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattat |
486 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
2939780 |
ccggggttcgaaccccagaccttgcatatattat |
2939813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 10724010 - 10723965
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
10724010 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 460 - 493
Target Start/End: Original strand, 18782544 - 18782577
Alignment:
| Q |
460 |
tcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
18782544 |
tcgaaccccagaccttgcatatattatgcattgt |
18782577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 19595468 - 19595513
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacata-tattatgcat |
490 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
19595468 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcat |
19595513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 23407018 - 23407055
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23407018 |
gggtttgaaccccagaccttgcatatattatgcattgt |
23407055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 24593437 - 24593400
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
24593437 |
gggttcgaaccccggaccttgcatatattatgcattgt |
24593400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 27848229 - 27848184
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
27848229 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 4927446 - 4927486
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
4927446 |
ccggggtttgaaccccggaccttacatatattatgctttgt |
4927486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 6765670 - 6765634
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
6765670 |
ggttcgaaccccggaccttacatattttatgcattgt |
6765634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 10735821 - 10735865
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
10735821 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 11810379 - 11810419
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
11810379 |
ccggggttcgaaccccagactttgcacatattatgcattgt |
11810419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 12124605 - 12124569
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgt |
12124569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 15447704 - 15447748
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
15447704 |
gtggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Complemental strand, 16390674 - 16390630
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||| |||||||| |
|
|
| T |
16390674 |
gtggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 459 - 491
Target Start/End: Complemental strand, 31156871 - 31156839
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31156871 |
ttcgaaccccagatcttacatatattatgcatt |
31156839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 34685961 - 34686001
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34685961 |
ccggtgttcgaaccccggaccttacatacattatgcattgt |
34686001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 34708382 - 34708422
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34708382 |
ccggtgttcgaaccccggaccttacatacattatgcattgt |
34708422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 41526777 - 41526813
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
41526777 |
ggttcgaaccccagaccttgcatatactatgcattgt |
41526813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 42791359 - 42791319
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
42791359 |
ccggggtttgaaccccggaccttgcatatattatgcattgt |
42791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 43117183 - 43117227
Alignment:
| Q |
449 |
gtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
43117183 |
gtgactggggtttgaacctcagaccttgcatatattatgcattgt |
43117227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000005; HSPs: 32)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 1244695 - 1244742
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1244695 |
gtggtgtccggggttcgaaccccagaccttgtatatattatgcattgt |
1244742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 9192217 - 9192264
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
9192217 |
gtggtggccggggtttgaaccccagactttacatatattatgcattgt |
9192264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 19260569 - 19260616
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19260569 |
gtggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 30623356 - 30623317
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30623356 |
cggggttcgaaccccagaccttgcatatattatgcattgt |
30623317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 38763505 - 38763552
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| || |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38763505 |
gtggtggccagggttcgaaccccagaccttgcatatattatgcattgt |
38763552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Complemental strand, 7433202 - 7433164
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7433202 |
ggggttcgaatcccagaccttacatatattatgcattgt |
7433164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 26914061 - 26914106
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
26914061 |
gtggtgaccagggttcgaaccccagaccttacatattttatacatt |
26914106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 28440022 - 28439985
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28440022 |
cggggtttgaaccccagaccttacatatattatgcatt |
28439985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 41603122 - 41603085
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41603122 |
gggtttgaaccccagaccttacatatattatgcattgt |
41603085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 44293636 - 44293599
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44293636 |
gggttcgaaccccagatcttacatatattatgcattgt |
44293599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 15188959 - 15188923
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15188959 |
ggttcgaaccccagatcttacatatattatgcattgt |
15188923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 31466242 - 31466282
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
31466242 |
ccggggttcgaacccgagaccttacatctattatgcattgt |
31466282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 41625256 - 41625220
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41625256 |
ggggttcgaaccctagaccttacatatattatgcatt |
41625220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 6038265 - 6038312
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
6038265 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgt |
6038312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 12748972 - 12748925
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
12748972 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 27044880 - 27044927
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
27044880 |
gtggtgtccggggtttgaacctcagaccttacatatattatgaattgt |
27044927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 32051522 - 32051569
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
32051522 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 463 - 493
Target Start/End: Complemental strand, 2181182 - 2181152
Alignment:
| Q |
463 |
aaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2181182 |
aaccccagaccttacatatattatgcattgt |
2181152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 461 - 491
Target Start/End: Original strand, 19701349 - 19701379
Alignment:
| Q |
461 |
cgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19701349 |
cgaaccccagaccttacatatattatgcatt |
19701379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 33373751 - 33373789
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
33373751 |
ggggtttgaaccccagaccttacatatattatgaattgt |
33373789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 34073754 - 34073792
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34073754 |
ggggttcgaacgtcagaccttacatatattatgcattgt |
34073792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 3650591 - 3650546
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3650591 |
gtggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 458 - 487
Target Start/End: Complemental strand, 6439055 - 6439026
Alignment:
| Q |
458 |
gttcgaaccccagaccttacatatattatg |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6439055 |
gttcgaaccccagaccttacatatattatg |
6439026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Complemental strand, 13958874 - 13958837
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13958874 |
cgggattcgaaccccaaaccttacatatattatgcatt |
13958837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 31685286 - 31685242
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
31685286 |
gtggtggccgggtttcgaacccca-accttacatatattatgcatt |
31685242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 39821945 - 39821908
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgt |
39821908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 6235541 - 6235585
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
6235541 |
gtggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 7404840 - 7404804
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7404840 |
ggggttcgaacctcagaccttatatatattatgcatt |
7404804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 8078101 - 8078137
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8078101 |
ggttcgaacatcagaccttacatatattatgcattgt |
8078137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 30176409 - 30176453
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
30176409 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 490
Target Start/End: Original strand, 36392913 - 36392957
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||| |||||||| |
|
|
| T |
36392913 |
gtggtgactggggtttgaagcccagaccttacatattttatgcat |
36392957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 44159133 - 44159085
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatat-attatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| || |||||||||||| |
|
|
| T |
44159133 |
gtggtggccggagttcgaaccccagaccttacaaatcattatgcattgt |
44159085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 54)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 3936698 - 3936651
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3936698 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 11144655 - 11144702
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
11144655 |
gtggtgtccggggttcaaaccccagaccttgcatatattatgcattgt |
11144702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 22164267 - 22164306
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22164267 |
cggggtttgaaccccagaccttacatatattatgcattgt |
22164306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 47806254 - 47806293
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47806254 |
cggggttcgaaccccagaccttgcatatattatgcattgt |
47806293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 49473716 - 49473669
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
49473716 |
gtggtgactggggttcgaaccccggaccttgcatatattatgcattgt |
49473669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 56497598 - 56497645
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56497598 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgt |
56497645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 37800901 - 37800855
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37800901 |
tggtgatcggggttcgaaccccagacctcgcatatattatgcattgt |
37800855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 1657030 - 1657067
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1657030 |
gggttcgaaccccaaaccttacatatattatgcattgt |
1657067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 3580785 - 3580740
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
3580785 |
gtggtgtccggggttcgaatcccagaccttgcatatattatgcatt |
3580740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 14542760 - 14542797
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14542760 |
gggttcgaaccccagaccttgcatatattatgcattgt |
14542797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 37255009 - 37254972
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37255009 |
gggttcgaaccccggaccttacatatattatgcattgt |
37254972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 49308881 - 49308844
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgt |
49308844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 24785459 - 24785499
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24785459 |
ccggggttcgaaccccagaccttgtatatattatgcattgt |
24785499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 24822807 - 24822767
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24822807 |
ccggggttcgaaccccagaccttgtatatattatgcattgt |
24822767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 52132299 - 52132339
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
52132299 |
ccggggttcgaaccacagaccttgcatatattatgcattgt |
52132339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 462 - 493
Target Start/End: Complemental strand, 160764 - 160733
Alignment:
| Q |
462 |
gaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
160764 |
gaaccccagaccttacatatattatgcattgt |
160733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 9783970 - 9783923
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
9783970 |
gtggtggccgaggtttgaacctcagaccttacatatattatgcattgt |
9783923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 10006411 - 10006364
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10006411 |
gtggtggccggtattcgaaccccagaccttgcatatattatgcattgt |
10006364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 456 - 491
Target Start/End: Original strand, 18903758 - 18903793
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18903758 |
gggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 20799384 - 20799431
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| ||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
20799384 |
gtggtgaccagggtttgaaccccggaccttgcatatattatgcattgt |
20799431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 27655801 - 27655755
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
27655801 |
gtggtggccggggttcgaaccc-agaccttgcatatattatgcattgt |
27655755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 29568657 - 29568610
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| | |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29568657 |
gtggtgtctggggttcgaacctcggaccttacatatattatgcattgt |
29568610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 36071215 - 36071168
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36071215 |
gtggtgcccggcgttcgaaccccgaaccttacatatattatgcattgt |
36071168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 38375028 - 38374981
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
38375028 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgt |
38374981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 39974573 - 39974526
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39974573 |
gtggtgtccgaggtttgaaccccagaccttccatatattatgcattgt |
39974526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 43034332 - 43034379
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
43034332 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
43034379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 45029595 - 45029642
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45029595 |
gtggtgaccgatattcgaaccccaaaccttacatatattatgcattgt |
45029642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 49041971 - 49042018
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
49041971 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
49042018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Original strand, 7371539 - 7371585
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
7371539 |
tggtgtccggggttcgaaccccggaccttgcatatattatgtattgt |
7371585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Original strand, 9028075 - 9028109
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9028075 |
ttcgaaccccagaccttacatattttatgcattgt |
9028109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Complemental strand, 12698655 - 12698621
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12698655 |
ttcgaaccccagaccttgcatatattatgcattgt |
12698621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Original strand, 21266885 - 21266919
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21266885 |
ttcgaaccccaaaccttacatatattatgcattgt |
21266919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 487
Target Start/End: Complemental strand, 10035336 - 10035295
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatg |
487 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10035336 |
gtggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 458 - 491
Target Start/End: Complemental strand, 11198823 - 11198790
Alignment:
| Q |
458 |
gttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
11198823 |
gttcgaaccccagaccttacatattttatgcatt |
11198790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Original strand, 14202477 - 14202514
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
14202477 |
cggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 486
Target Start/End: Original strand, 19486706 - 19486739
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattat |
486 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
19486706 |
ccggggttcgaaccccagatcttacatatattat |
19486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Original strand, 24664989 - 24665026
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
24664989 |
cggggttcgaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 30420903 - 30420866
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
30420903 |
gggttcgaaccctagaccttacatatattatacattgt |
30420866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 32737735 - 32737772
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
32737735 |
gggttcgaaccccagaccttgcatatattatacattgt |
32737772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 43722826 - 43722789
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgt |
43722789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 44221508 - 44221471
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
44221508 |
gggttcgaacctcagaccttgcatatattatgcattgt |
44221471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 54294412 - 54294457
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
54294412 |
gtggtgtccggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 56329597 - 56329560
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
56329597 |
gggttcgaaccccaaaccttacatttattatgcattgt |
56329560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 459 - 491
Target Start/End: Original strand, 2228399 - 2228431
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
2228399 |
ttcgaatcccagaccttacatatattatgcatt |
2228431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 6087809 - 6087773
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6087809 |
ggggtttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 6459925 - 6459961
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6459925 |
ggttcgaactccggaccttacatatattatgcattgt |
6459961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 6474503 - 6474463
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
6474503 |
ccggggttcgaaccccagaccttgcttatatgatgcattgt |
6474463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 10564462 - 10564502
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| ||||| |
|
|
| T |
10564462 |
ccggggtttgaacctcagaccttacatatattatgtattgt |
10564502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 11692723 - 11692675
Alignment:
| Q |
446 |
gtggtgaccggggttcgaacccc-agaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11692723 |
gtggtgaccggagtttgaacccccagaccttgcatatattatgcattgt |
11692675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 16431680 - 16431640
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
16431680 |
ccggggtttgaaccccagaccttgcatattttatgcattgt |
16431640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 25783442 - 25783486
Alignment:
| Q |
449 |
gtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
25783442 |
gtgaccggagtttgaaccccggaccttgcatatattatgcattgt |
25783486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 29808269 - 29808305
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
29808269 |
ggttcgaaccccataccttgcatatattatgcattgt |
29808305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 37735849 - 37735813
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
37735849 |
ggtttgaacctcagaccttacatatattatgcattgt |
37735813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 449 - 493
Target Start/End: Original strand, 48226491 - 48226535
Alignment:
| Q |
449 |
gtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| || |||||||||||||| ||||| ||||||||||| |
|
|
| T |
48226491 |
gtgaccgggatttgaaccccagaccttgcatattttatgcattgt |
48226535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000005; HSPs: 51)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 25441490 - 25441537
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25441490 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
25441537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 53996370 - 53996323
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53996370 |
gtggtggccgggattcgaaccccagaccttgcatatattatgcattgt |
53996323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 13829076 - 13829114
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
13829114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 26610492 - 26610530
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26610492 |
ggggttcgaaccccataccttacatatattatgcattgt |
26610530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 447 - 493
Target Start/End: Original strand, 28965768 - 28965814
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
28965768 |
tggtgaccggggtttgaaccccgaaccttacatatattatgcattgt |
28965814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 35191816 - 35191854
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
35191854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 25505701 - 25505738
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25505701 |
gggttcgaaccccagaccttgcatatattatgcattgt |
25505738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 25730473 - 25730428
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25730473 |
gtggtggccggggttcgaaccccagaccttgtatatattatgcatt |
25730428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 19939038 - 19939078
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19939038 |
ccggcgttcgaaccccagacctttcatatattatgcattgt |
19939078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 21245853 - 21245817
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21245853 |
ggtttgaaccccagaccttacatatattatgcattgt |
21245817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 456 - 492
Target Start/End: Complemental strand, 53208031 - 53207995
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattg |
492 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53208031 |
gggttcgaaccccagaccttgcatatattatgcattg |
53207995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 54230096 - 54230136
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
54230096 |
ccggggttcgaaccccaaaccttgcatatattatgcattgt |
54230136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 55494749 - 55494713
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55494749 |
ggttcgaaccccagtccttacatatattatgcattgt |
55494713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 1149059 - 1149106
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| || |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
1149059 |
gtggtgtccagggttcgaaccctagaccttgcatatattatgcattgt |
1149106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 2186425 - 2186464
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2186425 |
cggggtttgaaccccagaccttacatatattatgtattgt |
2186464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 4760178 - 4760131
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||| | |||||||| ||||||||||||||||| |
|
|
| T |
4760178 |
gtggtgaccgggattcgaatctcagaccttgcatatattatgcattgt |
4760131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Original strand, 7464489 - 7464528
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7464489 |
cggggtttgaaccccggaccttacatatattatgcattgt |
7464528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 7827571 - 7827532
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7827571 |
cgggtttcgaactccagaccttacatatattatgcattgt |
7827532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 8075856 - 8075809
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
8075856 |
gtggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
8075809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 8238635 - 8238588
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8238635 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
8238588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 14149536 - 14149583
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||| |||||| |
|
|
| T |
14149536 |
gtggtgtccggggttcgaaccccagaccttgcatacattatacattgt |
14149583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 16792964 - 16793011
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
16792964 |
gtggtgaccggggtttgaaccctggaccttgcatatattatgcattgt |
16793011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 27143117 - 27143070
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
27143117 |
gtggtgtccgggattcgaaccctagaccttacatatattatacattgt |
27143070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 27432305 - 27432258
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27432305 |
gtggtggccggaattcgaaccccataccttacatatattatgcattgt |
27432258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 28130924 - 28130971
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
28130924 |
gtggtgtccgggattcaaaccccagaccttgcatatattatgcattgt |
28130971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 28244094 - 28244141
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
28244094 |
gtggtgatcggggttcgaaccccggaccttgcatattttatgcattgt |
28244141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 32843252 - 32843299
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
32843252 |
gtggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
32843299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 38130949 - 38130996
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
38130949 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 45096097 - 45096050
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| | |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
45096097 |
gtggtgtctggggttcgaaccacagaccttgcatatattatgcattgt |
45096050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 48688185 - 48688138
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| || ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
48688185 |
gtggtgactggagttcgaacctcaaaccttacatatattatgcattgt |
48688138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 48849753 - 48849800
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
48849753 |
gtggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Original strand, 8747239 - 8747273
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
8747239 |
ttcgaaccccggaccttacatatattatgcattgt |
8747273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 15507268 - 15507306
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
15507268 |
ccgggattcgaacctcagaccttacatatattatgcatt |
15507306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 21914070 - 21914108
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
21914070 |
ggggttcgaaccccataccttgcatatattatgcattgt |
21914108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 30200896 - 30200850
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
30200896 |
tggtgtccggggttcgaacctcaaaccttgcatatattatgcattgt |
30200850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 453 - 491
Target Start/End: Complemental strand, 48376899 - 48376861
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
48376899 |
ccgggattcgaaccccaaaccttacatatattatgcatt |
48376861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 52119446 - 52119400
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgt |
52119400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 454 - 491
Target Start/End: Original strand, 4947824 - 4947861
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
4947824 |
cggggttcaaaccccagaccttacatattttatgcatt |
4947861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 14771402 - 14771357
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
14771402 |
gtggtgtccgggattcgaacctcagaccttgcatatattatgcatt |
14771357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 22251450 - 22251495
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||||||| |||| | ||||||||||||||| |
|
|
| T |
22251450 |
gtggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 448 - 493
Target Start/End: Complemental strand, 42074172 - 42074127
Alignment:
| Q |
448 |
ggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
42074172 |
ggtggccggagttcgaacctcagaccttgcatatattatgcattgt |
42074127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 4825399 - 4825363
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
4825399 |
ggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 14160275 - 14160315
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
14160275 |
ccggggttcgaaccccggactttgcatatattatgcattgt |
14160315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 20612274 - 20612314
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
20612274 |
ccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 21160114 - 21160078
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
21160114 |
ggggtttgaacccccgaccttacatatattatgcatt |
21160078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 21506755 - 21506795
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
21506755 |
ccggggttcaaaccccagaccttgcatattttatgcattgt |
21506795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 31463546 - 31463510
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31463546 |
ggggtttgaacctcagaccttacatatattatgcatt |
31463510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 34442444 - 34442484
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
34442444 |
ccggggtttgaaccccggaccttacatattttatgcattgt |
34442484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 455 - 491
Target Start/End: Complemental strand, 35557155 - 35557119
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
35557155 |
ggggtttgaaccccagaccttacatattttatgcatt |
35557119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 44579700 - 44579660
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
44579700 |
ccggggttcgaaccccggaccttgcatattttatgcattgt |
44579660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 459 - 491
Target Start/End: Original strand, 53633620 - 53633652
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
53633620 |
ttcgaaccccggaccttacatatattatgcatt |
53633652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000005; HSPs: 34)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 458 - 493
Target Start/End: Original strand, 29798118 - 29798153
Alignment:
| Q |
458 |
gttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29798118 |
gttcgaaccccagaccttacatatattatgcattgt |
29798153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 34083408 - 34083361
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34083408 |
gtggtggctggggttcgaaccccaaaccttacatatattatgcattgt |
34083361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 41973326 - 41973279
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
41973326 |
gtggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
41973279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 9398412 - 9398450
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9398412 |
ggggttcgaaccccagaccttacatatatcatgcattgt |
9398450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 3481632 - 3481587
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3481632 |
gtggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 49431983 - 49432028
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49431983 |
gtggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 455 - 487
Target Start/End: Complemental strand, 4859145 - 4859113
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatg |
487 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4859145 |
ggggttcgaaccccagaccttacatatattatg |
4859113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 10132445 - 10132481
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10132445 |
ggttcgaaccccagaccttgcatatattatgcattgt |
10132481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 11681287 - 11681247
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
11681287 |
ccggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 24752637 - 24752685
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacata-tattatgcattgt |
493 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
24752637 |
gtggtggccggggttcgaaccccagaccttgcatattattatgcattgt |
24752685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 446 - 486
Target Start/End: Original strand, 34083626 - 34083666
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattat |
486 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
34083626 |
gtggtgaccgcggttcgaaccccggaccttacatatattat |
34083666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 459 - 491
Target Start/End: Complemental strand, 34485935 - 34485903
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34485935 |
ttcgaaccccagaccttacatatattatgcatt |
34485903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 3136678 - 3136725
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3136678 |
gtggtgtccggaattcgaaccctagaccttacatatattatgcattgt |
3136725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 489
Target Start/End: Complemental strand, 5280694 - 5280659
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgca |
489 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5280694 |
cggggttcgaaccccagaccttgcatatattatgca |
5280659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 16033440 - 16033487
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
16033440 |
gtggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
16033487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 21638184 - 21638137
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
21638184 |
gtggtgtccggggttcgaaccccggaccttgcatatatcatgcattgt |
21638137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 454 - 493
Target Start/End: Complemental strand, 32944799 - 32944760
Alignment:
| Q |
454 |
cggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32944799 |
cggggttcgaaccccagacgttgcatatattatgcattgt |
32944760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 38448856 - 38448903
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
38448856 |
gtggtgtccgggattcgaaccccggaccttgcatatattatgcattgt |
38448903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 42045362 - 42045409
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
42045362 |
gtggtggccggggtttgaactccagaccttgcatatattatgcattgt |
42045409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 29233973 - 29234011
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
29233973 |
ggggttcgaaccccagaccttgcatattttatgcattgt |
29234011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 455 - 493
Target Start/End: Original strand, 29987111 - 29987149
Alignment:
| Q |
455 |
ggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
29987111 |
ggggttcgaactccagaccttgcatatattatgcattgt |
29987149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Complemental strand, 30937545 - 30937499
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||||||||| |||||| |
|
|
| T |
30937545 |
tggtgtccggagttcgaaccccagaccttgcatatattatacattgt |
30937499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 453 - 491
Target Start/End: Original strand, 35337120 - 35337158
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35337120 |
ccggggttcgaaccgcagaccttatatatattatgcatt |
35337158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 453 - 490
Target Start/End: Original strand, 11354015 - 11354052
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcat |
490 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11354015 |
ccggggttcaaaccccagaccttgcatatattatgcat |
11354052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Original strand, 21400023 - 21400060
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21400023 |
gggttcgaacccaagaccttgcatatattatgcattgt |
21400060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 29251815 - 29251778
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
29251815 |
gggttcgaacctcagaccttgcatatattatgcattgt |
29251778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 489
Target Start/End: Complemental strand, 5033603 - 5033571
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgca |
489 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
5033603 |
ggttcgaaccccagaccttgcatatattatgca |
5033571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 9413862 - 9413822
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9413862 |
ccgggattcgaaccccgaaccttacatatattatgcattgt |
9413822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Complemental strand, 21016022 - 21015986
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21016022 |
ggttcgaaccccgaaccttacatatattatgcattgt |
21015986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 457 - 493
Target Start/End: Original strand, 25165093 - 25165129
Alignment:
| Q |
457 |
ggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
25165093 |
ggtttgaacccgagaccttacatatattatgcattgt |
25165129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 25533037 - 25532997
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
25533037 |
ccggggtttgaaccccggaccttgcatatattatgcattgt |
25532997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Original strand, 28039857 - 28039897
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
28039857 |
ccggggttcaaacctcagaccttgcatatattatgcattgt |
28039897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 456 - 492
Target Start/End: Original strand, 42440148 - 42440184
Alignment:
| Q |
456 |
gggttcgaaccccagaccttacatatattatgcattg |
492 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
42440148 |
gggtttgaactccagaccttacatatattatgcattg |
42440184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 453 - 493
Target Start/End: Complemental strand, 45481557 - 45481517
Alignment:
| Q |
453 |
ccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
45481557 |
ccggagttcgaaccccggaccttgcatatattatgcattgt |
45481517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0426 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0426
Description:
Target: scaffold0426; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 5830 - 5875
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5830 |
gtggtgtctggggttcgaaccccagaccttacatatattatacatt |
5875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 7051 - 7003
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacata-tattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7051 |
gtggtggccgggattcgaaccccagaccttacatattattatgcattgt |
7003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Original strand, 7210 - 7257
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
7210 |
gtggtgtccggggttcgaaccccagaccttatatataatatgcgttgt |
7257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0350 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0350
Description:
Target: scaffold0350; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 1319 - 1272
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| |||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
1319 |
gtggtggccggagtttgaactccagaccttacatatattatgcattgt |
1272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 17575 - 17528
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
17575 |
gtggtgtccgggattcgaaccccaaaccttgcatatattatgcattgt |
17528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 446 - 493
Target Start/End: Complemental strand, 75396 - 75349
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||| ||||| |||||||||| |||||| ||||||||||||||||| |
|
|
| T |
75396 |
gtggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
75349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 447 - 493
Target Start/End: Original strand, 189963 - 190009
Alignment:
| Q |
447 |
tggtgaccggggttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
189963 |
tggtgaccagggtttgaaccccgaaccttacatatattatgcattgt |
190009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 459 - 493
Target Start/End: Original strand, 119201 - 119235
Alignment:
| Q |
459 |
ttcgaaccccagaccttacatatattatgcattgt |
493 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
119201 |
ttcgaacctcagaccttacatatattatgcattgt |
119235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 4541 - 4496
Alignment:
| Q |
446 |
gtggtgaccggggttcgaaccccagaccttacatatattatgcatt |
491 |
Q |
| |
|
|||||| ||||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
4541 |
gtggtgtccgggattcgaactctagaccttacatatattatgcatt |
4496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University