View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7229_low_37 (Length: 242)
Name: NF7229_low_37
Description: NF7229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7229_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 102 - 232
Target Start/End: Complemental strand, 33822423 - 33822293
Alignment:
| Q |
102 |
gttaatattattgtcgtgtgaagagatatgtttcagttgttgaaagcctatagggcatgcaagtgattatctcttcataattaactcaattattagatga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33822423 |
gttaatattattgtcgtgtgaagagatatgtttcagttgttgaaagcctatagggcatgcaagtgattatctcttcataattaactcaattattagatga |
33822324 |
T |
|
| Q |
202 |
tgatgatataatctagtcccatattcttcga |
232 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |
|
|
| T |
33822323 |
tgatgatataatctagtcccattttcctcga |
33822293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 33822518 - 33822480
Alignment:
| Q |
19 |
caaatttcttttgttgcttcagtttacctgtcattgcag |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33822518 |
caaatttcttttgttgcttcagtttacctgtcattgcag |
33822480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University