View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7229_low_38 (Length: 236)
Name: NF7229_low_38
Description: NF7229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7229_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 6485713 - 6485510
Alignment:
| Q |
17 |
gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485713 |
gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg |
6485614 |
T |
|
| Q |
117 |
tggtgcttctgatggattggttaacttttgggaacgtgataaacaatttgaacatggtggggtcctcaagggtcataagcttgcagttttgtgtttagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485613 |
tggtgcttctgatggattggttaacttttgggaacgtgataagcaatttgaacatggtggagtcctcaagggtcataagcttgcagttttgtgtttagct |
6485514 |
T |
|
| Q |
217 |
tctg |
220 |
Q |
| |
|
|||| |
|
|
| T |
6485513 |
tctg |
6485510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 25702734 - 25702695
Alignment:
| Q |
110 |
tttattgtggtgcttctgatggattggttaacttttggga |
149 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
25702734 |
tttattgcggttcttctgatggattggttaacttttggga |
25702695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University