View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7230_low_11 (Length: 231)
Name: NF7230_low_11
Description: NF7230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7230_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 6955930 - 6955712
Alignment:
| Q |
1 |
gccctaatttctaagaacaagcttcgatttatcgacggcacttttcaatgtccttcatctacgaatgtcttgcatgagccatggatccgctgcaacaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6955930 |
gccctaatttctaagaacaagcttcgatttatcgacggcagttttcaatgtccttcatctacgaatgtcttgcacgagccatggatccgctgcaacaaca |
6955831 |
T |
 |
| Q |
101 |
tggttctctcatggcttcaacgctcaatttctgaaagtatttctaaatccattttatggatcgacaaagcctcctctgtttggacaaatcttgaacttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
6955830 |
tggttctctcatggcttcaacgctcaatttctgaaagtatttctaaatccattttatggatcgacaaagtctcttctgtttggccaaatcttgaacttcg |
6955731 |
T |
 |
| Q |
201 |
tttttcacaaggggatatt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6955730 |
tttttcacaaggggatatt |
6955712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 90 - 219
Target Start/End: Original strand, 22454767 - 22454896
Alignment:
| Q |
90 |
ctgcaacaacatggttctctcatggcttcaacgctcaatttctgaaagtatttctaaatccattttatggatcgacaaagcctcctctgtttggacaaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22454767 |
ctgcaacaacatggttctctcatggcttcaatgctcaatttttgaaagtatttctaaatccattttatggatcgacaaagcctcctctgtttggacaaat |
22454866 |
T |
 |
| Q |
190 |
cttgaacttcgtttttcacaaggggatatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22454867 |
cttgaacttcgtttttcacaaggggatatt |
22454896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University