View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7231_high_13 (Length: 255)
Name: NF7231_high_13
Description: NF7231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7231_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 4705715 - 4705969
Alignment:
| Q |
1 |
tcattgtctttcaaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705715 |
tcattgtctttcgaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa |
4705814 |
T |
 |
| Q |
101 |
aatgttgagatttacaataccttttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgatttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4705815 |
aatgttgagatttacaataccttttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgttttgc |
4705914 |
T |
 |
| Q |
201 |
tattagttatggtgtatgaattgatctatgaggcactcacaccaaactcgacacc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4705915 |
tattagttatggtgtatgaattgatctatgaggcactcacaccaaactcgacacc |
4705969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University