View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7231_low_12 (Length: 305)
Name: NF7231_low_12
Description: NF7231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7231_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 111 - 277
Target Start/End: Complemental strand, 44593570 - 44593404
Alignment:
| Q |
111 |
caagagtagcggcctatattcgtcaattaggtgatcctacgctgcagctatacctgctgttatactgaatctctgccaatgtctagttgtgttggtgtga |
210 |
Q |
| |
|
||||||| | ||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44593570 |
caagagtggtggcttatattcgtcaattaggtgatcctacgttgcagctatgcctgctgttatactgaatctctgccaatgtctagttgtgttggtgtga |
44593471 |
T |
 |
| Q |
211 |
attgtgatgtctcttcgtttttgttattttccataaaacatcggttttgttctaaataaatcgacta |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44593470 |
attgtgatgtctcttcgtttttgttattttccataaaacatcggttttgttctaaataaatcgacta |
44593404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 44593660 - 44593599
Alignment:
| Q |
13 |
aatatatataattgatgatctgatatattgtatataaaatagagtagattagattaggaagg |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44593660 |
aatatatataattgatgatctgatatattgtatataaaatagagtagattagattaggaagg |
44593599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University