View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7231_low_18 (Length: 276)
Name: NF7231_low_18
Description: NF7231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7231_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 5012062 - 5011815
Alignment:
| Q |
15 |
atgtctatcttttgttccgaaggctctagacaccctcacaattctcggatcttttagttttaaccattgcgatgttgttgacgatgatgtagttgaatca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5012062 |
atgtctatcttttgttccgaaggctctagacaccctcacaattctcggatcctttagttttaaccattgcgatgttgttgacgatgatgtagttgaatca |
5011963 |
T |
 |
| Q |
115 |
ttcgatggaagaacttcttgttttaatggaaattcggcttcttttggaatgttaatcatcttatttctctcattgttgttgttggtctccttccatggta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5011962 |
ttcgatggaagaacttcttgttttaatggaaattcggcttcttttggaatgttaatcatcttatttctctcattgttgttgttggtctccttccatggta |
5011863 |
T |
 |
| Q |
215 |
aaatgttgttgttttggttgaaattctctctaattttgaattttgctt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5011862 |
aaatgttgttgttttggttgaaattctctctaattttgaattttgctt |
5011815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University