View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7231_low_33 (Length: 210)
Name: NF7231_low_33
Description: NF7231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7231_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 36397182 - 36397368
Alignment:
| Q |
11 |
cgaagaatatatcagaaatagaatagcacttgattgttcttaaatgaattggcatggcataagttcttctgctagattttcactacacaatccagattgt |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36397182 |
cgaagaaaatatcagaaatagaatagcacttgattgttcttaaatgaattggcatggcataagttcttctgctagattttcactacacaatccaaattgt |
36397281 |
T |
|
| Q |
111 |
ctgtttagtgtttataattctatttttgtcctttacaagtcacactacattcaatataaagaatgcttatgttttaaattgatgtcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36397282 |
ctgtttagtgtttataattctatttttgtcctttacaagtcacactacattcaatataaagaatgcttatgttttaaattcatgtcc |
36397368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University