View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7232_low_3 (Length: 264)
Name: NF7232_low_3
Description: NF7232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7232_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 8438223 - 8438454
Alignment:
| Q |
20 |
tcaacatcgttacatgttcggcttaggtcaaccaagaaagggtatatctctatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8438223 |
tcaacatcgttacatgttcggcttaggtcaaccaagaaagggtatatctctatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttat |
8438322 |
T |
|
| Q |
120 |
cttttgctgattcaagtgcttcgtcgaactcttctatgctgtgaactctttgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438323 |
cttttgctgattcaagtgcttcgtcgaactcttctatgctatgaactctttgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgt |
8438422 |
T |
|
| Q |
220 |
tgcttttgtgataacaacacgtcgtctctgct |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
8438423 |
tgctttggtgataacaacacgtcgtctctgct |
8438454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University