View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7232_low_4 (Length: 238)
Name: NF7232_low_4
Description: NF7232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7232_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 25724090 - 25724294
Alignment:
| Q |
20 |
ctagcggggacctatggagcaaccatcaactaattggagtgtgaaagaccc--acattgatgttgtttaaaaaacaaacatcttgctctaaagaaaccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25724090 |
ctagcggggacctatggagcaaccatcaactaattggagtgtgaaagacccccacattgatgttgtttaaaaaacaaacatcttgctctaaagaaaccat |
25724189 |
T |
|
| Q |
118 |
attaaatgggacattcaaacacgaccctatagttatctttgttgtaaggaaggctgtaagctttgggcacttccgccagaccgtcactttctgtcaatat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25724190 |
attaaatgggacattcaaacacgaccctatagttatctttgttgtaagtaaggctgtaagctttggacacttccgccagaccgtcactttctgtcaatat |
25724289 |
T |
|
| Q |
218 |
cacag |
222 |
Q |
| |
|
||||| |
|
|
| T |
25724290 |
cacag |
25724294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University