View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7233_low_17 (Length: 263)
Name: NF7233_low_17
Description: NF7233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7233_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 246
Target Start/End: Original strand, 6169771 - 6170002
Alignment:
| Q |
12 |
aaacatagaaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaacataggattttctgcaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169771 |
aaacatagaaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaacataggattttctgcaatgt |
6169870 |
T |
|
| Q |
112 |
caatagcctcatttgtcccgttggtgttttcaaatcgaccaacgtaacgtgtacactttcatccattcgtcgacaacttttgttccaaaaaaggatgagg |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169871 |
caatagcttcatttgtcccgttggtgttttcaaatcgaccaatgtaacgtgtacactttcatgcattcgtcgacaacttttgttccaaaaaaggatgagg |
6169970 |
T |
|
| Q |
212 |
gtttctactactaatctctacatgatcactcgcac |
246 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
6169971 |
gttt---ctactaatctctacatgatcactcgcac |
6170002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University