View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7233_low_20 (Length: 228)
Name: NF7233_low_20
Description: NF7233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7233_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 174
Target Start/End: Complemental strand, 28380322 - 28380170
Alignment:
| Q |
21 |
agattctagacaactagcaagaacacgatgacctttggagtgactatgagctgaaatgcatattcaacttcatcaatggtcgattttgtatgtaacatcc |
120 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28380322 |
agattctagacaacaatcaagaacacgatgacctttggagtgactatgagctgaa-tgcatattcaacttcatcaatggtcgattttgtatgtaacatcc |
28380224 |
T |
|
| Q |
121 |
attcagagcttatcatagactaatgagaccacattgttctctttacctcttcaa |
174 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28380223 |
attcagagcttattatagactaatgagaccacattgttctctttacctcttcaa |
28380170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 172 - 211
Target Start/End: Complemental strand, 28380139 - 28380100
Alignment:
| Q |
172 |
caatcacttgttttatttatacattattaatccccatctt |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28380139 |
caatcacttcttttatttatacattattaatccccatctt |
28380100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University