View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7234_low_1 (Length: 406)
Name: NF7234_low_1
Description: NF7234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7234_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 6e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 294 - 395
Target Start/End: Original strand, 21144596 - 21144698
Alignment:
| Q |
294 |
attttggtgggattctcattt-agggagatgaaggaatggaatccaagcttagtggccagcaaaataactgtttggattaaaatcctaagtttaccagtt |
392 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21144596 |
attttggtgggattctcattttagggagatgaaggaatggaatccaagcttagtggccagcaaaagaactgtttggattaaaatcctaagtttaccagtt |
21144695 |
T |
 |
| Q |
393 |
cat |
395 |
Q |
| |
|
||| |
|
|
| T |
21144696 |
cat |
21144698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University