View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7235_high_5 (Length: 313)
Name: NF7235_high_5
Description: NF7235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7235_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 47 - 303
Target Start/End: Complemental strand, 37632884 - 37632627
Alignment:
| Q |
47 |
ttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgtat |
146 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37632884 |
ttagcaacatgtttttggtttgtatggctactctctggcaggcaattttggggttatctttgtatgccttgtcattggtgtatgactgtgtatggtgtat |
37632785 |
T |
 |
| Q |
147 |
tgtccccc-ttcgagcacatatagtggaagccttttccaacccttcatagaaggtgggtagaggtatcttgttgtgatgcttgcggcagagtttttaata |
245 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37632784 |
tgtccccccttcgagcacatatagtgtaagccctttccaacccttcatagaaggtgggtagagttatcttgttatgatgcttgcggcagagtttttaata |
37632685 |
T |
 |
| Q |
246 |
ttttaattcatcgagaaaaacaacaaaaatgaagaagtatgaattgcatgtagaataa |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37632684 |
ttttaattcatcgagaaaaacaacaaaaatgcagaagtatgaattgcatgtagaataa |
37632627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 46 - 165
Target Start/End: Complemental strand, 28697452 - 28697333
Alignment:
| Q |
46 |
attagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgta |
145 |
Q |
| |
|
||||||||| |||||||||||||||| || |||| |||| || ||| | | ||||||||||||||||||| |||||||||||| ||||||||| | || |
|
|
| T |
28697452 |
attagcaacctgtttttggtctgtatagcatctctttggcgggtaatatcggtgttatctttgtatgccttgccattggtgtatgtctttgtatgatcta |
28697353 |
T |
 |
| Q |
146 |
ttgtcccccttcgagcacat |
165 |
Q |
| |
|
|||| | ||||||| ||||| |
|
|
| T |
28697352 |
ttgtacaccttcgaacacat |
28697333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University