View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7235_high_5 (Length: 313)

Name: NF7235_high_5
Description: NF7235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7235_high_5
NF7235_high_5
[»] chr3 (1 HSPs)
chr3 (47-303)||(37632627-37632884)
[»] chr1 (1 HSPs)
chr1 (46-165)||(28697333-28697452)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 47 - 303
Target Start/End: Complemental strand, 37632884 - 37632627
Alignment:
47 ttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgtat 146  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||    
37632884 ttagcaacatgtttttggtttgtatggctactctctggcaggcaattttggggttatctttgtatgccttgtcattggtgtatgactgtgtatggtgtat 37632785  T
147 tgtccccc-ttcgagcacatatagtggaagccttttccaacccttcatagaaggtgggtagaggtatcttgttgtgatgcttgcggcagagtttttaata 245  Q
    |||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
37632784 tgtccccccttcgagcacatatagtgtaagccctttccaacccttcatagaaggtgggtagagttatcttgttatgatgcttgcggcagagtttttaata 37632685  T
246 ttttaattcatcgagaaaaacaacaaaaatgaagaagtatgaattgcatgtagaataa 303  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
37632684 ttttaattcatcgagaaaaacaacaaaaatgcagaagtatgaattgcatgtagaataa 37632627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 46 - 165
Target Start/End: Complemental strand, 28697452 - 28697333
Alignment:
46 attagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgtatgactttgtatggtgta 145  Q
    ||||||||| |||||||||||||||| ||  |||| |||| || ||| |  | ||||||||||||||||||| |||||||||||| ||||||||| | ||    
28697452 attagcaacctgtttttggtctgtatagcatctctttggcgggtaatatcggtgttatctttgtatgccttgccattggtgtatgtctttgtatgatcta 28697353  T
146 ttgtcccccttcgagcacat 165  Q
    |||| | ||||||| |||||    
28697352 ttgtacaccttcgaacacat 28697333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University