View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7235_low_10 (Length: 246)
Name: NF7235_low_10
Description: NF7235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7235_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 45845107 - 45845323
Alignment:
| Q |
19 |
tgtttatcttaataatctgagtcagcaaatgattaagaagaatcttccttaatttcagctttaagtaacttctcttcatcaacttctttgctgtcatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845107 |
tgtttatcttaataatctgagtcagcaaatgattaagaagaatcttccttaatttcagctttaagtaacttctcttcatcaacttctttgctgtcatcaa |
45845206 |
T |
 |
| Q |
119 |
taaaaacatcacttgtttttgttgcttctccaattccagttaatttcttagctcttagtgcttcacaatcccaatctgtttgactcaaaacaaccaacat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845207 |
taaaaacatcacttgtttttgttgcttctccaattccagttaatttcttagctcttagtgcttcacaatcccaatctgtttgactcaaaacaaccaacat |
45845306 |
T |
 |
| Q |
219 |
agtcacagcacaggttc |
235 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
45845307 |
agtcacagcacaagttc |
45845323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University