View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7235_low_11 (Length: 239)
Name: NF7235_low_11
Description: NF7235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7235_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 54671051 - 54670830
Alignment:
| Q |
1 |
cttcattctatgattactattttttgattataataatataaaagaataatatta-tttatttatgctgcaattgtgatcatggaagtagatcaaagcgtg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54671051 |
cttcattctatgattactattttttgattataataatataaaagaataatattaatttatttatgctgcaattgtgatcatggaagtagatcaaagcgtg |
54670952 |
T |
|
| Q |
100 |
gctttttatggtacttgtctttcatgatttcactatccgaaatccaaatggagtttctctttctcaaatcaaaggtacgccttgttactattcattctct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54670951 |
gctttttatggtacttgtctttcatgatttcattatccgaaatccaaatggagtttctctttctcaaatcaaaggtacgccttgttactattcattctct |
54670852 |
T |
|
| Q |
200 |
aacagaaaatttagtctattaa |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54670851 |
aacagaaaatttagtctattaa |
54670830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University