View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7237_high_1 (Length: 472)
Name: NF7237_high_1
Description: NF7237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7237_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 197 - 457
Target Start/End: Original strand, 33054512 - 33054772
Alignment:
| Q |
197 |
tcatcgtacaccctttaactttctttaccttattcttttccattatcactttcactcactcccaaaccaacgatgcttccatcatgcaaaccctaaaaaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054512 |
tcatcgtacaccctttaactttctttaccttattcttttccattatcactttcactcactcccaaaccaacgatgcttccatcatgcaaaccctaaaaaa |
33054611 |
T |
|
| Q |
297 |
caacctaaaaccgcctctttcacttggttggtccgacccggatccatgtaaatggacccacgtttcttgttctgacgacaaccgtgtaacgagaatccaa |
396 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33054612 |
caaccttaaaccgcctctttcgcttggttggtccgacccggatccatgtaaatggacccacgtttcttgttccgacgacaaccgtgtaacgagaatccaa |
33054711 |
T |
|
| Q |
397 |
atcggtcgccagaatctccatggcacacttcctcaaacccttcaaaaccttaccaacttac |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054712 |
atcggtcgccagaatctccatggcacacttcctcaaacccttcaaaaccttaccaacttac |
33054772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 10 - 114
Target Start/End: Original strand, 33054323 - 33054427
Alignment:
| Q |
10 |
atggacatcactaccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcttctcactcttattcgtaactaac |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33054323 |
atggtcatcactaccctgtctttcagatacatgggccccacttgcatgtgcattactctccgagttctccccattcttctcactcttattcgtaactaac |
33054422 |
T |
|
| Q |
110 |
caaaa |
114 |
Q |
| |
|
||||| |
|
|
| T |
33054423 |
caaaa |
33054427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University