View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7237_low_9 (Length: 220)
Name: NF7237_low_9
Description: NF7237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7237_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 68 - 204
Target Start/End: Original strand, 13770470 - 13770606
Alignment:
| Q |
68 |
ggtggtccatttttgcaataataattattagtttcttagttataaagcaggtgacggatgggatcaaccatgtcttcagaagtccaaaagtccatgaagc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770470 |
ggtggtccatttttgcaataataattattagtttcttagttataaaacaggtgacggatgggatcaaccatgtcttcagaagtccaaaagtccatgaaga |
13770569 |
T |
 |
| Q |
168 |
tgttgtcccaatcagcaggcatggtgaaaggcacagg |
204 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13770570 |
tgctgtcccaatcagcaggcatggtgaaaggcacagg |
13770606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University