View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7238_low_8 (Length: 239)
Name: NF7238_low_8
Description: NF7238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7238_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 135 - 223
Target Start/End: Complemental strand, 32598144 - 32598056
Alignment:
| Q |
135 |
gatgtggtggcggcatagtactatcgtccttctaactatatacttgagaatattgttaagatgtacataattacattcaaaaaacatag |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598144 |
gatgtggtggcggcatagtactatcgtccttctaactatatacttgagaatattgttaagatgtacataattacattcaaaaaacatag |
32598056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 32598233 - 32598146
Alignment:
| Q |
1 |
attgaacagaatatacatatagctttagaattaaaatttttatagatttataacacaaaaatgata----gataaaaaagatggtagc |
84 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
32598233 |
attgaacaaaatatacatatagctttagaattaaaatatttatagatttgtaagacaaaaatgatagatagataaaaaagatggtagc |
32598146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University