View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7239_high_18 (Length: 223)
Name: NF7239_high_18
Description: NF7239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7239_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 21 - 198
Target Start/End: Complemental strand, 2355591 - 2355406
Alignment:
| Q |
21 |
actatcaagctttgatgtatctacgacgaatggattgcgaaatcctcatcgggcttttgtacaaccttcgg---nnnnnnnccccctcaatataacaaac |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2355591 |
actatcaagctttcatgtatctacgacgaatggattgcgaaatcctcatcgggtttttgtacaaccttcgggttttttttttcccctcaatataacaaac |
2355492 |
T |
 |
| Q |
118 |
aatcttggacgatgagtgtagtagattttttatat-----atnnnnnnnnntggatatacgagtcgcaaaccaatccacaattctg |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355491 |
aatcttggacaatgagtgtagtagattttttttatataaaattaaaaaaaatggatatacgagtcgcaaaccaatccacaattctg |
2355406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University