View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7239_low_29 (Length: 206)

Name: NF7239_low_29
Description: NF7239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7239_low_29
NF7239_low_29
[»] chr8 (1 HSPs)
chr8 (19-95)||(1415243-1415322)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 1415322 - 1415243
Alignment:
19 cacctatcatcatacaaatcaacat---cttttttcttattagcttaagacattattaattaatatattatacgagtctt 95  Q
    |||||||||||||||||||||||||   ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
1415322 cacctatcatcatacaaatcaacatgatcttttttctaattagcttaagacattattaattaatatattatacgagtctt 1415243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University