View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7239_low_29 (Length: 206)
Name: NF7239_low_29
Description: NF7239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7239_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 1415322 - 1415243
Alignment:
| Q |
19 |
cacctatcatcatacaaatcaacat---cttttttcttattagcttaagacattattaattaatatattatacgagtctt |
95 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1415322 |
cacctatcatcatacaaatcaacatgatcttttttctaattagcttaagacattattaattaatatattatacgagtctt |
1415243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University