View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_high_35 (Length: 239)
Name: NF7240_high_35
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_high_35 |
 |  |
|
| [»] scaffold0135 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 221
Target Start/End: Original strand, 9200228 - 9200327
Alignment:
| Q |
122 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacatagaa |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9200228 |
atacctcttctctatcataacttcatgttcgttttcgtttggatcactcaatgttacatatgtagaaatttgatacccaaactcccttgtaaacatagaa |
9200327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 217
Target Start/End: Original strand, 9201990 - 9202085
Alignment:
| Q |
122 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacat |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
9201990 |
atacctcttctctatcataacttcatgttcgtttccgtttggatcactcaatgttacatatgtagaaatttaatacccaaactcccttgtaaacat |
9202085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0135 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0135
Description:
Target: scaffold0135; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 217
Target Start/End: Original strand, 72 - 167
Alignment:
| Q |
122 |
ataccttttctctatcataacttcatgttcgtttctgtttggatcacacaagtttacatacgtagcaatttgatacccaaactcccttgtaaacat |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| ||| ||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
72 |
atacctcttctctatcataacttcatgttcgtttccgtttggatcactcaatgttacatatgtagaaatttaatacccaaactcccttgtaaacat |
167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University