View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_high_42 (Length: 224)
Name: NF7240_high_42
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 54601713 - 54601512
Alignment:
| Q |
1 |
tgtactaacttgtattggcatgtattgctgaatataattgaatgaagttacacacaaaacatatatactatgttttgaccatgatttactatatatgttt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54601713 |
tgtaccaacttgtattggcatgtattgctgaatataattgaatgaagttacacacaaaacatatatactatgttttgaccatgatctactatatatgttt |
54601614 |
T |
 |
| Q |
101 |
gcaaaatggcaatacaaaaatcctgtg-ggattaaataaatgaacaagtatatatagcagaccaaagtaatccgtctcttctttaaacttctatttgttc |
199 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54601613 |
gcaaaatggctatacaaaaatcctgtgtggattaaataaatgaacaagtatatatagcagaccaaagtaatccgtctcttctttaaacttctatttgttc |
54601514 |
T |
 |
| Q |
200 |
ct |
201 |
Q |
| |
|
|| |
|
|
| T |
54601513 |
ct |
54601512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University