View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_low_25 (Length: 303)
Name: NF7240_low_25
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 9 - 288
Target Start/End: Original strand, 46185680 - 46185959
Alignment:
| Q |
9 |
acctgtgttcagatacctgcactgtgaattctaaaaagtattgtactctatcatcaaatgataaatttgctttcattttcatagccgaaacacgaaggtt |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185680 |
acctgtgttcagatacctccactgtgaattctaaaaagtattgtactctatcatcaaatgataaatttgctttcattttcatagccgaaacacgaaggtt |
46185779 |
T |
 |
| Q |
109 |
accaaattctagaataatgaacttgtataaattccctgattcttcagcaagatcaactaatgaacttgctttttgttgtgcatgcacccttcttaaaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185780 |
accaaattctagaataatgaacttgtataaattctctgattcttcagcaagatcaactaatgaacttgctttttgttgtgcatgcacccttcttaaaatc |
46185879 |
T |
 |
| Q |
209 |
ttttggtacgtagcatccttggtccaatgttgcagaatgaaatgatcagggatttgcacaataccttttgattgaaaaat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185880 |
ttttggtacgtagcatccttggtccaatgttgcagaatgaaatgatcagggatttgcacaataccttttgattgaaaaat |
46185959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University