View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_low_39 (Length: 238)
Name: NF7240_low_39
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 15733217 - 15733430
Alignment:
| Q |
1 |
gaaagaaaatacatagaaagagaaaataataagtagagacatcgatcacatgt-tgacaagcatcaatccctgatatgtagatgttcaattattagtacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15733217 |
gaaagaaaatacatagaaagagaaaataa---gtagagacatcgatcacatgtatgacaagcatcaatccctgatatgtagatattcaattattagtacc |
15733313 |
T |
 |
| Q |
100 |
atggtcgannnnnnnactgacatcgtcgaacactgtatagtgaggagggtcacgaaatggaattataatcaaacttcttatcactgaactgaactttgct |
199 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15733314 |
atggtcgatttttttactgacatcgtcgaatactgtatagtgaggagggtcacgaaatggaattataatcaaacttcttatcactgaactgaactttgct |
15733413 |
T |
 |
| Q |
200 |
ttctccagttttgtggc |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15733414 |
ttctccagttttgtggc |
15733430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University