View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_low_42 (Length: 234)
Name: NF7240_low_42
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 8438251 - 8438454
Alignment:
| Q |
18 |
caaccaagaaagggtatatctctatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttgtcttttgctgattcaagtgcttcgtcgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8438251 |
caaccaagaaagggtatatctctatgctttctgagtcgtcgcttgtagcgtactcaacaacaacgagtttatcttttgctgattcaagtgcttcgtcgaa |
8438350 |
T |
|
| Q |
118 |
ctcttctatgctgtgaactctttgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgttgcttttgtgataacaacacgtcgtctc |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8438351 |
ctcttctatgctatgaactctttgaactcttgcatcttttttcttcttagcatctgaagctgctgtgcctgttgctttggtgataacaacacgtcgtctc |
8438450 |
T |
|
| Q |
218 |
tgct |
221 |
Q |
| |
|
|||| |
|
|
| T |
8438451 |
tgct |
8438454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University