View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7240_low_44 (Length: 227)
Name: NF7240_low_44
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7240_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 172
Target Start/End: Original strand, 11808931 - 11809087
Alignment:
| Q |
16 |
caccaccattgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttggggatggtatgtcctaaacataacttcttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11808931 |
caccaccattgtttagatattgttcagatcaatggagcttggatattgtgttcccagattggtccttttggggatggtatgtcctaaacataacttcttt |
11809030 |
T |
|
| Q |
116 |
tcttcctttctatttatagaaacatgtttaaatcacgagaattaagaaaattgatag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11809031 |
tcttcctttctatttatagaaacatgtttaaatcacgagaattaagaaaattgatag |
11809087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 136
Target Start/End: Original strand, 11801657 - 11801768
Alignment:
| Q |
24 |
ttgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttggggatggtatgtcctaaacataacttcttttcttcctt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||| ||||| |
|
|
| T |
11801657 |
ttgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttggggatggtaaatgctaaac-taacttcttttcatcctt |
11801755 |
T |
|
| Q |
124 |
tctatttatagaa |
136 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
11801756 |
tctatttttagaa |
11801768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University