View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7240_low_45 (Length: 224)

Name: NF7240_low_45
Description: NF7240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7240_low_45
NF7240_low_45
[»] chr3 (1 HSPs)
chr3 (1-201)||(54601512-54601713)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 54601713 - 54601512
Alignment:
1 tgtactaacttgtattggcatgtattgctgaatataattgaatgaagttacacacaaaacatatatactatgttttgaccatgatttactatatatgttt 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
54601713 tgtaccaacttgtattggcatgtattgctgaatataattgaatgaagttacacacaaaacatatatactatgttttgaccatgatctactatatatgttt 54601614  T
101 gcaaaatggcaatacaaaaatcctgtg-ggattaaataaatgaacaagtatatatagcagaccaaagtaatccgtctcttctttaaacttctatttgttc 199  Q
    |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54601613 gcaaaatggctatacaaaaatcctgtgtggattaaataaatgaacaagtatatatagcagaccaaagtaatccgtctcttctttaaacttctatttgttc 54601514  T
200 ct 201  Q
    ||    
54601513 ct 54601512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University