View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7241_low_20 (Length: 299)
Name: NF7241_low_20
Description: NF7241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7241_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 280
Target Start/End: Original strand, 3898716 - 3898980
Alignment:
| Q |
16 |
gacatcaaacaatttggacaagatgcaaatgaaaagacaaaggacgctgcgagttcaattgcggataaagcaaaagaagacacagacaaggctgttgagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898716 |
gacatcaaacaatttggacaagatgcaaatgaaaagacaaaggacgctgcaagttcaattgcggataaagcaaaagaagacacagacaaggctgttgagg |
3898815 |
T |
 |
| Q |
116 |
cagtagggagtgctggagataaggttaaagattatgcttatgatgcaaatgacaaaaccaaggaagcaataggttctgctactgataaggcaaaagaagg |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898816 |
cagtagggagtgctggagataaggtaaaagattatgcttatgatgcaaatgacaaaaccaaggaagcaataggttctgctactgataaggcaaaagaagg |
3898915 |
T |
 |
| Q |
216 |
atttgaggcagcaacgaagaacacacaggaggctgctgggtcagcgacagaggctctgaagaatg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3898916 |
atttgaggcagcaacgaagaacacacaggaggctgctgggtcagcgacagaggctctgaagaatg |
3898980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University