View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7242_high_10 (Length: 240)
Name: NF7242_high_10
Description: NF7242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7242_high_10 |
 |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 136705 - 136920
Alignment:
| Q |
1 |
ttgcagcggctttgtaagcatcaatatcgtcatacaatggaagtcaacacaatttggatcacacttgccgcgaatggagttaaaaacagaatgaatcgat |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
136705 |
ttgcagcggctttgtaagcatcagtatcgtcatacaatggaagtcaacactatttggatcacacttgccac-----gagttaaaaacagaatgaatcgat |
136799 |
T |
 |
| Q |
101 |
atcataactcattgcaacaagaactaaacagctccccatcataattacttccaaacaagttaagaacagaatgcaattggaaaccctcgtgaaactccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
136800 |
atcataactcattgcaacaagaactaaacagctccccatcataattacttccaaacaagttaagaacagaatgcaattggaaaccctcgtgaaactccta |
136899 |
T |
 |
| Q |
201 |
caaatttcgttccttcttgtc |
221 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
136900 |
caaatgtcgttccttcttgtc |
136920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 112 - 176
Target Start/End: Original strand, 140437 - 140500
Alignment:
| Q |
112 |
ttgcaacaagaactaaacagctccccatcataattacttccaaacaagttaagaacagaatgcaa |
176 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
140437 |
ttgcaacaagaactaaacggctccacat-ataattacttccaaacaagttaagaacggaatgcaa |
140500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 140345 - 140408
Alignment:
| Q |
1 |
ttgcagcggctttgtaagcatcaatatcgtcat-acaatggaagtcaacacaatttggatcaca |
63 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
140345 |
ttgcggcggctttgtaagcatcagtatcgtcatcacagtggaagtcaacacaatttggaccaca |
140408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University