View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7242_low_7 (Length: 313)
Name: NF7242_low_7
Description: NF7242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7242_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 49866128 - 49865826
Alignment:
| Q |
1 |
atgtctaacaataacaattacaaagcggtctccatgttggcaaccgttgaatcaagataaggacaacttagatttcaagcagatttttt-atatttgatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49866128 |
atgtctaacaataacaattacaaagcggtctccatgttggcaaccgttggatcaagataaggacaacttagatttcaagcagatttttttatatttgatt |
49866029 |
T |
 |
| Q |
100 |
taaaaaactaaaatctctatgtagtgactgcgtcaattcaagaatttgtaacttcttggaacctcccgattccgatcccccgtactctaagtttatgtct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49866028 |
taaaaaactaaaatctctatgtagtgactgcgtgaattcaagaatttgtaacttcttggaacctcccgattccgatcccccatactctaagtttatgtct |
49865929 |
T |
 |
| Q |
200 |
taatttgcaatttagttatcataatgcctattttttgcttggttaatttgcagcctctacatacggggtttaccacagacaagggaggaaatttaattga |
299 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49865928 |
taatttgcaatttagctatcataatgcctattttttgcttggttaatttgcagcctctacatacggggtttaccacagataagggaggaaatttaattga |
49865829 |
T |
 |
| Q |
300 |
tgt |
302 |
Q |
| |
|
||| |
|
|
| T |
49865828 |
tgt |
49865826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University