View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7243_high_8 (Length: 312)
Name: NF7243_high_8
Description: NF7243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7243_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 35964406 - 35964279
Alignment:
| Q |
1 |
tgcaaaaagggttcaacattcaaatttcaggggattcaaagtcaataaaacacagatttttagtgtaaacttatggagttgagggggttcatttgaacac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
35964406 |
tgcaaaaatggttcaacattcaaatttcaggggattcaaagtcaataaaatacagatttttagtgtaaacatatagagttgagggggtttatttgaacac |
35964307 |
T |
 |
| Q |
101 |
cctgactaacacatggctccgcccatgg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35964306 |
cctgactaacacatggctccgcccatgg |
35964279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 189 - 294
Target Start/End: Original strand, 25754433 - 25754538
Alignment:
| Q |
189 |
ttttgatgggaagtggagggggtggatgtgagcatgtttgcttcagcgtcattattggttttcgtaaatggttgtcggacaaaacaagtggttattcgta |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25754433 |
ttttgatgggaagtggagggggtggatgtgagcatgtttgcttcagcgtcattattggttttcgtaaatggttgtcggacaaaagaagtggttattcgta |
25754532 |
T |
 |
| Q |
289 |
agggtc |
294 |
Q |
| |
|
|||||| |
|
|
| T |
25754533 |
agggtc |
25754538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 231
Target Start/End: Original strand, 25771001 - 25771043
Alignment:
| Q |
189 |
ttttgatgggaagtggagggggtggatgtgagcatgtttgctt |
231 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
25771001 |
ttttgatgggaagtggatggggtggatttgagcatgtgtgctt |
25771043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 45054661 - 45054546
Alignment:
| Q |
1 |
tgcaaaaagggttcaacattcaaatttcaggggattcaaagtcaataaaacacagatttttagtgtaaacttatggagttgagggggttcatttgaacac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| || || || || |||||||||| ||| ||| |||||||||| || | |||||||||||||||| ||| | |
|
|
| T |
45054661 |
tgcaaaaagggttcaatattcaaattttagagggtttaaggtcaataaaatacatattattagtgtaaatttgtaaagttgagggggttcatatgattat |
45054562 |
T |
 |
| Q |
101 |
cctgactaacacatgg |
116 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45054561 |
tctgactaacacatgg |
45054546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University