View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7243_low_17 (Length: 250)
Name: NF7243_low_17
Description: NF7243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7243_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 4235038 - 4235274
Alignment:
| Q |
1 |
atcagtactacatagagatgtagaaacacacgaacttataatcttgttgataatgtcaacatgaattgttggcgggactctatccaagtcccaaatacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4235038 |
atcagtactacatagagatgtagaaacacacgaacttataatcttgttgataatgtcaacatgaattgttggcgggactctatccaagtctcaaatacaa |
4235137 |
T |
 |
| Q |
101 |
aatacaattttcagtcacatattgtctaaccaacttaattaacaaccatgcacttaatttgtttattgtttacgagattacacccaaaagccaactttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4235138 |
aatacaattttcagtcacatattgtctaaccaacttaattaacaaccggacacttaatttgtttattgtttacgagattacacccaaaagccaacttcat |
4235237 |
T |
 |
| Q |
201 |
aagaaaaattaacatacaggattaaattatatgatgt |
237 |
Q |
| |
|
| |||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
4235238 |
aggaaaaattaacatacatgatcaaattatacgatgt |
4235274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University