View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7243_low_18 (Length: 236)
Name: NF7243_low_18
Description: NF7243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7243_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 55 - 222
Target Start/End: Complemental strand, 20227784 - 20227617
Alignment:
| Q |
55 |
cggagcccaacccaatctccaaaatattactccctctccaatttggtgcctaatgttgataaggatcaaagttctctcaaagatcaaaattctctccaat |
154 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20227784 |
cggagcccaacccagtctctaaaatattactccctctccaatttggtgcctaatgtagataaggatcaaagttctctcaaagatcaaaattctctccaat |
20227685 |
T |
|
| Q |
155 |
tcgtgtttactaagttagacaaaaatcctattgaggaagggtttgaagaagatttgttaggtgcaata |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20227684 |
tcgtgtttactaagttagacaaaaatcctattgaggaagggtttgaagaagatttgttaggcgcaata |
20227617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University