View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7243_low_19 (Length: 208)
Name: NF7243_low_19
Description: NF7243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7243_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 52836644 - 52836463
Alignment:
| Q |
1 |
cacaacatatggcaaaggaaaatgaatctcctattcctattattaggtcaagcaatatataaccattagagaatccaccctctttgctgaaggtgaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52836644 |
cacaacatatggcaaaggaaaatgaatctcctat-------attaggtcaagcaatatataaccattagagaatccaccctctttgctgaaggtgaatga |
52836552 |
T |
 |
| Q |
101 |
ccaaatttttaaagaggaaacatgtacctactcagacttcgaactttatcttctttggagcaggctggaggttacccacctgtaacagc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52836551 |
ccaaatttttaaagaggaaacatgtacctactcagactttgaactttatcttctttggagcaggctggaggttgcccacctgtaacagc |
52836463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 91 - 189
Target Start/End: Original strand, 48967386 - 48967485
Alignment:
| Q |
91 |
aggtgaatgaccaaatttttaaagaggaaacatgt-acctactcagacttcgaactttatcttctttggagcaggctggaggttacccacctgtaacagc |
189 |
Q |
| |
|
||||||||||| ||| ||||||||| ||| ||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
48967386 |
aggtgaatgactaaacttttaaagaagaagcatgttacctactcagtcttcgaactttatcttctttggagcagactggaggttacccacctgcaacagc |
48967485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University