View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7244_high_5 (Length: 226)
Name: NF7244_high_5
Description: NF7244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7244_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 27785319 - 27785528
Alignment:
| Q |
1 |
tgctgatattttctggctccttagtgagcatgatggttttattgtttcattcaactgcattaatatgacttgtattgtatagcctaagctggaattttcc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27785319 |
tgctgatattttctggctccttaatgagcatgatggttttattgtttcattcaactgcattaatatgacttgtattgtatagcctaagctggaattttca |
27785418 |
T |
 |
| Q |
101 |
gatagtccttagttcaatttcctttgctctgaaaccatagagcacagatttcagattgcttgaatggcatggtgtgttcatgttatcagttcggggaata |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27785419 |
gatagaccttagttcaatttcctttgctctgaaaccatagagcacaaatttcagattgcttgaatggcatggtgtgttcatgttatcagttcggggaata |
27785518 |
T |
 |
| Q |
201 |
ccgtgggaat |
210 |
Q |
| |
|
|| ||||||| |
|
|
| T |
27785519 |
ccatgggaat |
27785528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University