View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7245_high_6 (Length: 373)
Name: NF7245_high_6
Description: NF7245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7245_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 17 - 362
Target Start/End: Complemental strand, 44199349 - 44199004
Alignment:
| Q |
17 |
aggaggatatgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199349 |
aggaggatatgcgagcgaggccatagcccgaaacaccatctggggaacgaatggctttgagtttttggtgagagggaagggtgaagagagtttgtccaag |
44199250 |
T |
|
| Q |
117 |
ccattgaatttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199249 |
ccattgaatttcatcaaggaggcttattgggatgccatggttcaccacttgatacacaccccatgttttgcatgcatgtcctattaactttgaagcattt |
44199150 |
T |
|
| Q |
217 |
gggtcattgagatcaataacgggaacaatactactagtagtaccctccttaataagggtgtgatcatcaaggtggttccaagtgtaagattcaggaagtt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199149 |
gggtcattgagatcaataacgggaacaatactactagtagtaccctccttaataagggtgtgatcatcaaggtggttccaagtgtaagattcaggaagtt |
44199050 |
T |
|
| Q |
317 |
cttgtagtgaattgaaatcagggtgcttgtggttaacatgcacagg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199049 |
cttgtagtgaattgaaatcagggtgcttgtggttaacatgcacagg |
44199004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University