View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7245_low_11 (Length: 242)
Name: NF7245_low_11
Description: NF7245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7245_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 32630422 - 32630210
Alignment:
| Q |
18 |
caaacctacataatcctagctgctggagctgtattaacagaggttctataccttgctgaatatggagtccctactgcaggatggagttcagcttgtgggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32630422 |
caaacctacataatcctagctgctggagctgtattaacagaggttctataccttgctgaatatggagtccctactgcaggatggagttcagcttgtgggt |
32630323 |
T |
 |
| Q |
118 |
cttttggttcattttgtcacaagatcaaagcttcattagttatcacatttattgctgtggtttgctatattttgctttcactcatatcctcttatagact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32630322 |
cttttggttcattttgtcacaagatcaaagcttcattagttatcacatttattgctgtggtttgctatattttgctttcactcatatcctcttatagact |
32630223 |
T |
 |
| Q |
218 |
atttagcaagtat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32630222 |
atttagcaagtat |
32630210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 105 - 167
Target Start/End: Complemental strand, 28941596 - 28941534
Alignment:
| Q |
105 |
tcagcttgtgggtcttttggttcattttgtcacaagatcaaagcttcattagttatcacattt |
167 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| ||| ||||||| ||| |||||||||| |
|
|
| T |
28941596 |
tcagcttgtggctcttttggtcaattttgtcacaaggtcacagcttcagtagctatcacattt |
28941534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University