View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7246_high_20 (Length: 327)
Name: NF7246_high_20
Description: NF7246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7246_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 4e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 165 - 225
Target Start/End: Original strand, 13479420 - 13479480
Alignment:
| Q |
165 |
tccaagctccttcgaatttttctgcgagaaacagacacgaataattaatcaaatcacaaca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479420 |
tccaagctccttcgaatttttctgcgagaaacagacacgaataattaatcaaatcacaaca |
13479480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 60 - 94
Target Start/End: Original strand, 13479315 - 13479349
Alignment:
| Q |
60 |
attcgaacaatttcaattttttcacgtaatcaata |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479315 |
attcgaacaatttcaattttttcacgtaatcaata |
13479349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University